Week 4: Primates

Lemurs:

a.)    Lemurs primarily reside in the tropical rainforests of Madagascar. Rainforests are typically humid, and has a lot of foliage.

b.)    My provided trait is Sociality and Mating patterns. The lemur social system is usually a group of no more than fifteen individual lemurs. The mating patterns for lemurs are that they breed depending on the season.

c.)     An environmental factor that has caused the lemurs to be seasonal breeders is that they mate depending on the availability of food in order to match up the highest availability of food with the weaning period of the lemurs. The environment can also be a factor as to why the lemurs run in fairly large packs, so as to gather food without fear of competition from larger predators.

d.)    

Spider Monkey:

a.)    Spider Monkeys are tree-top surfers. Spider Monkeys reside in semi deciduous and mangrove forests.

b.)    The spider monkey social system is fairly similar to our own. Spider monkeys live in medium sized groups, and even the spider monkey loners stay within a close proximity of the groups. Also, like us, the females are better at finding a better variety of food than the males. Spider monkeys do not have a particular mating season, like us they mate year-round.

c.)     Forests are home to many predators, both large and small, so it makes sense that spider monkeys tend to travel in fairly large-sized packs in order to defend themselves.

d.)  

Baboons:

a.)    Baboons live in a variety of different habitats and are very adaptive. The primary requirements of their habitat are that there is a water source and safe sleeping places (like trees and mountain sides).

b.)    Baboons also travel in groups of about 50 individuals, with a primary focus of that group being the women and children. Baboons also have a social hierarchy that promotes a single female as the leader. The mating patterns of baboons vary by group. The females are the primary caretakers of the young. There is no information on seasonal breeding, so I assume that they are an all-year breeding species.

c.)     Baboons travel in large groups, much like human settlers, but the hunting is generally carried out by a much smaller group. Baboons are very cunning and many groups thrive off of human developments in urban and sub-urban environments in order to snatch pre-gathered food from us. This smaller group can gather food with much less risk to the entire tribe, seeing as how baboons biggest predator seems to be humans.

d.)   

Gibbons:

a.)    Gibbons are primarily located in the old growth tropical rain forests of Southeast Asia

b.)    Gibbons are very similar to humans. They are diurnal, they live in small family groups (mother, father, and children), and they often groom each other. Gibbon mates generally stay together for their entire lifespan. Gibbons are able to reproduce at twelve years old, and the females are pregnant for approximately seven months, and only have one child generally.

c.)     Overall, the gibbons almost mimic the human life. Once the child becomes of-age, it ventures out into the unsuspecting world to find a mate. I am having a hard time thinking of environmental reasoning as to why they mate the way they do, or as to why the live in small, family-like groups.

d.)   

Chimpanzees:

a.)    Chimpanzees are generally found in wet savannas and rain forests.

b.)    Chimpanzees live in large communities that consist of multiple males and females. Chimpanzees also have a social hierarchy that is dictated by one individual’s influence on others. Chimpanzees become capable of reproduction at sixteen years of age. There is no evidence of a birth season, and it seems that they are not seasonal breeders. Mating partners, once in a community, are generally dictated by the hierarchy.

c.)     Forests are filled with large predators, so living in large communities is a way for them to protect their groups without being a very large species.

d.)    

 

Summary:

In the end, I have found that, across all of the species, there isn’t really a whole lot in common with mating. However, their social systems and statuses are very similar. There always seems to be a social hierarchy for all of the primates. Although their mating patterns differ quite a bit, their setup of ‘families’ seems to be the same in which the female provides the primary care for the offspring and the males are the actual gatherers of food and primary guardians of the family.

Week 3: Homologous vs Analogous

1.)    

a.)    My example of a homologous trait will be a Bat’s Wing, and the Human Arm. Bats are mammals and are able to fly due to the stretched skin across their finger bones. Humans are not able to fly using their hands because we do not have such features.

b.)    The homologous trait would be the fact that both the human hand and the bat’s wings have finger bones. However, bat’s finger bones are much longer and thinner than that of a human’s fingers. The skin of the bat’s fingers are stretched out across all of its fingers, including the webbing in order to make a full wing, while human’s webbing is detached to create individual fingers which are not optimal for flight.  I believe that we have differed from bat’s wings because bat’s rely on fast-paced flight as their primary source of movement, rather than walking like humans.

c.)     Humans and bats are both of the Mammal family

d.) 

2.)    

a.)    My example of Analogous traits will be Insect wings versus Bird wings. For insects I will be mainly discussing Butterflies, and representing the birds will be Owls.

b.)    The trait that is shared between Owls and Butterflies is that they both have wings that are meant for flight. However, the wings of each creature are quite different in its actual composition. An owl’s wings are comprised of bones, while a butterfly’s wings are boneless. Owl’s wings are covered in feathers, while the butterfly’s wings are scales. Therefore, because of the differences listed above, the possession of wings would be considered an analogous trait.

c.)     I can’t seem to find a common ancestor of these two creatures

d.)  

Protein Synthesis Sentence (assignment 2)

Here is my DNA strand:
ATGTTACACCTTAGGGAACGTCTCCCCGCGAATCGCGC

Happy word-searching

Historical Influence on Darwin: Thomas Malthus

1.) The person that I believe was the most influential on Charles Darwin was Thomas Malthus.

2.) Thomas Malthus was a British economist that was heavily influential to getting Charles Darwin on his path to hypothesizing the theory of natural selection. Darwin was influenced by Malthus' "Essay on the Principle of Population" in which it was stated that population growth would cause a shortage of food, which would detriment the survival of that population. (source: http://www.allaboutscience.org/thomas-malthus-faq.htm)

3.) The points that were influenced by Malthus were that all organisms have the potential of reproducing exponentially and that resources are limited. Darwin built upon both of these ideas that, in order to survive, there needs to be enough resources to sustain the population's size and rate of growth. Seeing as how resources cannot be created / controlled, population size is the only part that is left that can actually be controlled.

4.) No, I do not believe that Darwin could have developed his theory of natural selection without the influence of this essay because he would not have had the initial idea that populations need to be controlled in order to survive.

5.) It is strange that his book On the Origin of Species took twenty years to be published, but there isn't really any evidence that specifically blames the church for his delay in the release of his book. Some other reasons that I have read are that he wanted to ensure all of the books' authenticity and that he was ill for much of his adult life.