High altitude is a great subject to study.
Higher altitude environments have much less availability of oxygen due to the lowered atmospheric pressure, which makes it slightly tougher for human's to get the required oxygen into their bloodstreams. This obviously disturbs our homeostasis because our body isn't entirely used to trying to survive on less oxygen, so our body will work harder to get the oxygen it needs.
A short term adaptation to this lowered oxygen level is that our bodies increase our breathing and heart rate by as much as double, and our pulse rates and blood pressure increase due to the heart trying to pump more blood to get oxygen to cells. A facultative adaptation is rather hard to pinpoint here... The decrease in air pressure causes many changes in the body, but i guess the best example I can think of is how our ears adapt to the change in pressure. As our bodies move up and down through altitudes, our ears tend to 'pop' which isn't really a necessary feature of our bodies adapting to a change of external pressure. A developmental adaptation that our bodies do in order to adapt to a decrease of air pressure is that our bodies increase our red blood cell and capillary counts through a process known as acclimatization. Our lung size increases to contain the osmosis of oxygen and carbon dioxide. A cultural adaptation to higher altitudes could be how people have changed their own breathing styles. Some people have more hemoglobin, which allows them to expand their lungs much better than others. Some people have increased their rate of breathing to also adapt to the lowered oxygen levels.
High altitude training is a very common form of training for professional athletes. The benefits of higher altitude training is the fact that it increases your lungs ability to process oxygen and increases red blood cell counts. The study of how humans adapt to lowered oxygen environments has helped the world of professional athletes because it is a natural, and legal, way to train your body to be better than it was before.
Well, sickle cell anemia is a disease that is very problematic when it comes to higher altitudes. Sickle cell anemia is a disease that is predominant in people from tropical and sub-tropical regions where malaria is common, so it is a rather racial disease that could cause some very serious complications when introduced into an environment with lowered oxygen levels. Even still, the study of the environmental influences on high altitude adaptation is better than to just use race because it is a selective disease. The disease is basically reacting to the environmental changes that occurs around the body, so that is why it is better to study the environmental changes.
Tuesday, March 26, 2013
Tuesday, March 19, 2013
Week 7: talking without communication
Part 1.) This experiment was particularly easy for me, personally, but I can definitely see how it would be difficult to have an intelligent conversation. It was easy because the conversation was simple and I tend not to talk a lot anyways. The other participants in this experiment didn't change the way they talked normally... they only noticed that I hadn't said anything and just asked if anything was wrong and, when I shook my head, the conversation continued. Obviously the culture that would have the advantage is the one with a spoken language and the speaking culture would either try and adopt their form of communication into the one without. Individuals who might have difficulty communicating with a spoken language are people with hearing disabilities, problems with muteness, or any kind of disability that causes a barrier between having a conversation with someone else. Trying to communicate with someone who cannot communicate back is not easy, many times it requires writing down what you are saying, or having some kind of translator. Either way this extra mediator will lose some of the meaning of what you are saying.
Part 2.) Yes, I was able to last the full 15 minutes without anything but speech. It wasn't very difficult for me because I don't move very much in the first place and the conversation didn't really have anything that would call for any kind of emotion. The other participants weren't entirely affected by my lack of expression, but talking in monotone was making them fall asleep. Without any extra signs while we talk, it gets very difficult to get the emotion of what you are saying to stick with them and it is important to show some kind of extra embellishments to enhance what your saying and to get the primary point across. I am sure there are some people who have difficulty reading body language. For example, a blind person would not be able to see any kind of movements from another person. When you are able to see body language, you can see beyond a person's words. If someone was mad you could see it in their movements, even if their words are saying otherwise. I guess the only time that it would be appropriate to not be able to read body language is if you didn't want to know the truth about something that someone had said.
Part 2.) Yes, I was able to last the full 15 minutes without anything but speech. It wasn't very difficult for me because I don't move very much in the first place and the conversation didn't really have anything that would call for any kind of emotion. The other participants weren't entirely affected by my lack of expression, but talking in monotone was making them fall asleep. Without any extra signs while we talk, it gets very difficult to get the emotion of what you are saying to stick with them and it is important to show some kind of extra embellishments to enhance what your saying and to get the primary point across. I am sure there are some people who have difficulty reading body language. For example, a blind person would not be able to see any kind of movements from another person. When you are able to see body language, you can see beyond a person's words. If someone was mad you could see it in their movements, even if their words are saying otherwise. I guess the only time that it would be appropriate to not be able to read body language is if you didn't want to know the truth about something that someone had said.
Tuesday, March 5, 2013
week 5 piltdown hoax
The piltdown hoax was about an archaeology site in England in which ape and human fossils were discovered; however, after a short examination of the fossils, it was discovered that the primate skull was not of ancient age. In 1953 the hoax was revealed as piltdown man. It was discovered to be a hoax when the fossils were actually examined, instead of just plaster molds.
Although scientists can be very creative, they are also human which means they are prone to make mistakes. In the piltdown case, the scientists took the evidence at face value without examining the evidence in person. This makes the entire scientific community look bad. The scientific investigation team observed filing marks on the teeth of the primate using a microscope. And upon further investigation of the skull, it was discovered that the skull had been washed in an iron and chloric acid solution.
I do not believe that you can remove the human factor from it. If it were possible to remove the human factor, I don't believe it would be very beneficial compared to the detrements of missing the human influence.
Obviously the life lesson is that we shouldn't take things at face value because it can easily be false.
Although scientists can be very creative, they are also human which means they are prone to make mistakes. In the piltdown case, the scientists took the evidence at face value without examining the evidence in person. This makes the entire scientific community look bad. The scientific investigation team observed filing marks on the teeth of the primate using a microscope. And upon further investigation of the skull, it was discovered that the skull had been washed in an iron and chloric acid solution.
I do not believe that you can remove the human factor from it. If it were possible to remove the human factor, I don't believe it would be very beneficial compared to the detrements of missing the human influence.
Obviously the life lesson is that we shouldn't take things at face value because it can easily be false.
Tuesday, February 26, 2013
Week 4: Primates
Lemurs:
a.)
Lemurs primarily reside in the tropical
rainforests of Madagascar. Rainforests are typically humid, and has a lot of
foliage.
b.)
My provided trait is Sociality and Mating patterns.
The lemur social system is usually a group of no more than fifteen individual
lemurs. The mating patterns for lemurs are that they breed depending on the
season.
c.)
An environmental factor that has caused the
lemurs to be seasonal breeders is that they mate depending on the availability
of food in order to match up the highest availability of food with the weaning
period of the lemurs. The environment can also be a factor as to why the lemurs
run in fairly large packs, so as to gather food without fear of competition
from larger predators.
a.)
Spider Monkeys are tree-top surfers. Spider
Monkeys reside in semi deciduous and mangrove forests.
b.)
The spider monkey social system is fairly
similar to our own. Spider monkeys live in medium sized groups, and even the
spider monkey loners stay within a close proximity of the groups. Also, like
us, the females are better at finding a better variety of food than the males.
Spider monkeys do not have a particular mating season, like us they mate
year-round.
c.)
Forests are home to many predators, both large
and small, so it makes sense that spider monkeys tend to travel in fairly
large-sized packs in order to defend themselves.
Baboons:
a.)
Baboons live in a variety of different habitats
and are very adaptive. The primary requirements of their habitat are that there
is a water source and safe sleeping places (like trees and mountain sides).
b.)
Baboons also travel in groups of about 50
individuals, with a primary focus of that group being the women and children.
Baboons also have a social hierarchy that promotes a single female as the
leader. The mating patterns of baboons vary by group. The females are the
primary caretakers of the young. There is no information on seasonal breeding,
so I assume that they are an all-year breeding species.
c.)
Baboons travel in large groups, much like human
settlers, but the hunting is generally carried out by a much smaller group.
Baboons are very cunning and many groups thrive off of human developments in
urban and sub-urban environments in order to snatch pre-gathered food from us.
This smaller group can gather food with much less risk to the entire tribe,
seeing as how baboons biggest predator seems to be humans.
Gibbons:
a.)
Gibbons are primarily located in the old growth
tropical rain forests of Southeast Asia
b.)
Gibbons are very similar to humans. They are
diurnal, they live in small family groups (mother, father, and children), and
they often groom each other. Gibbon mates generally stay together for their
entire lifespan. Gibbons are able to reproduce at twelve years old, and the
females are pregnant for approximately seven months, and only have one child
generally.
c.)
Overall, the gibbons almost mimic the human
life. Once the child becomes of-age, it ventures out into the unsuspecting
world to find a mate. I am having a hard time thinking of environmental reasoning
as to why they mate the way they do, or as to why the live in small,
family-like groups.
d.) 

Chimpanzees:
a.)
Chimpanzees are generally found in wet savannas
and rain forests.
b.)
Chimpanzees live in large communities that
consist of multiple males and females. Chimpanzees also have a social hierarchy
that is dictated by one individual’s influence on others. Chimpanzees become
capable of reproduction at sixteen years of age. There is no evidence of a
birth season, and it seems that they are not seasonal breeders. Mating
partners, once in a community, are generally dictated by the hierarchy.
c.)
Forests are filled with large predators, so
living in large communities is a way for them to protect their groups without
being a very large species.
d.)

Summary:
In the end, I have found that, across all of the species,
there isn’t really a whole lot in common with mating. However, their social
systems and statuses are very similar. There always seems to be a social
hierarchy for all of the primates. Although their mating patterns differ quite
a bit, their setup of ‘families’ seems to be the same in which the female
provides the primary care for the offspring and the males are the actual
gatherers of food and primary guardians of the family.
Thursday, February 21, 2013
Week 3: Homologous vs Analogous
1.)
a.)
My example of a homologous trait will be a Bat’s
Wing, and the Human Arm. Bats are mammals and are able to fly due to the
stretched skin across their finger bones. Humans are not able to fly using
their hands because we do not have such features.
b.)
The homologous trait would be the fact that both
the human hand and the bat’s wings have finger bones. However, bat’s finger
bones are much longer and thinner than that of a human’s fingers. The skin of
the bat’s fingers are stretched out across all of its fingers, including the
webbing in order to make a full wing, while human’s webbing is detached to
create individual fingers which are not optimal for flight. I believe that we have differed from bat’s
wings because bat’s rely on fast-paced flight as their primary source of
movement, rather than walking like humans.
c.)
Humans and bats are both of the Mammal family
d.)
2.)
a.)
My example of Analogous traits will be Insect
wings versus Bird wings. For insects I will be mainly discussing Butterflies,
and representing the birds will be Owls.
b.)
The trait that is shared between Owls and
Butterflies is that they both have wings that are meant for flight. However,
the wings of each creature are quite different in its actual composition. An
owl’s wings are comprised of bones, while a butterfly’s wings are boneless. Owl’s
wings are covered in feathers, while the butterfly’s wings are scales.
Therefore, because of the differences listed above, the possession of wings
would be considered an analogous trait.
c.)
I can’t seem to find a common ancestor of these
two creatures
d.)
Tuesday, February 12, 2013
Protein Synthesis Sentence (assignment 2)
Here is my DNA strand:
ATGTTACACCTTAGGGAACGTCTCCCCGCGAATCGCGC
Happy word-searching
ATGTTACACCTTAGGGAACGTCTCCCCGCGAATCGCGC
Happy word-searching
Tuesday, February 5, 2013
Historical Influence on Darwin: Thomas Malthus
1.) The person that I believe was the most influential on Charles Darwin was Thomas Malthus.
2.) Thomas Malthus was a British economist that was heavily influential to getting Charles Darwin on his path to hypothesizing the theory of natural selection. Darwin was influenced by Malthus' "Essay on the Principle of Population" in which it was stated that population growth would cause a shortage of food, which would detriment the survival of that population. (source: http://www.allaboutscience.org/thomas-malthus-faq.htm)
3.) The points that were influenced by Malthus were that all organisms have the potential of reproducing exponentially and that resources are limited. Darwin built upon both of these ideas that, in order to survive, there needs to be enough resources to sustain the population's size and rate of growth. Seeing as how resources cannot be created / controlled, population size is the only part that is left that can actually be controlled.
4.) No, I do not believe that Darwin could have developed his theory of natural selection without the influence of this essay because he would not have had the initial idea that populations need to be controlled in order to survive.
5.) It is strange that his book On the Origin of Species took twenty years to be published, but there isn't really any evidence that specifically blames the church for his delay in the release of his book. Some other reasons that I have read are that he wanted to ensure all of the books' authenticity and that he was ill for much of his adult life.
2.) Thomas Malthus was a British economist that was heavily influential to getting Charles Darwin on his path to hypothesizing the theory of natural selection. Darwin was influenced by Malthus' "Essay on the Principle of Population" in which it was stated that population growth would cause a shortage of food, which would detriment the survival of that population. (source: http://www.allaboutscience.org/thomas-malthus-faq.htm)
3.) The points that were influenced by Malthus were that all organisms have the potential of reproducing exponentially and that resources are limited. Darwin built upon both of these ideas that, in order to survive, there needs to be enough resources to sustain the population's size and rate of growth. Seeing as how resources cannot be created / controlled, population size is the only part that is left that can actually be controlled.
4.) No, I do not believe that Darwin could have developed his theory of natural selection without the influence of this essay because he would not have had the initial idea that populations need to be controlled in order to survive.
5.) It is strange that his book On the Origin of Species took twenty years to be published, but there isn't really any evidence that specifically blames the church for his delay in the release of his book. Some other reasons that I have read are that he wanted to ensure all of the books' authenticity and that he was ill for much of his adult life.
Subscribe to:
Posts (Atom)






